Overslaan en naar de inhoud gaan

IMIS

Publicaties | Datasets
[ meld een fout in dit record ] Print deze pagina

Associated microbiome (Bacteria and Fungi) in Antarctic sea stars (healthy versus exhibiting epidermal disease)
Citatie
Núñez-Pons L, Work T, Angulo-Preckler C, Moles J, Avila C (2018): Associated microbiome (Bacteria and Fungi) in Antarctic sea stars (healthy versus exhibiting epidermal disease). v1.2. SCAR - Microbial Antarctic Resource System. Dataset/Metadata. https://ipt.biodiversity.aq/resource?r=associated_microbiome_antarctic_sea_stars&v=1.2 https://doi.org/10.15468/2fmwju

Toegang tot data
Gearchiveerde data
Beschikbaarheid: Creative Commons License Deze dataset valt onder een Creative Commons Naamsvermelding 4.0 Internationaal-licentie.

Beschrijving
Amplicon sequencing dataset (Illumina MiSeq) of bacteria (16S ssu rRNA gene) and Fungi (ITS) associated with healthy and diseased Antarctic sea stars (Odontaster validus). meer

Twenty-five healthy and diseased O validus (n = 50) were collected by SCUBA diving on February 2013. Tissue biopsies (1 cm3) were removed with sterile scalpel from 30 individuals (15 healthy and 15 diseased) as follows: 15 sections from healthy specimens, 15 affected lesion fronts from diseased sea stars, and 15 tissue areas several cm away from the lesions of the same diseased specimens. Samples were divided in two subsamples, one preserved in 100% ethanol at −20 °C for DNA extraction and microbial characterization, and the other fixed in 2.5% paraformaldehyde in filtered sea water at 4 °C for histopathology studies.

Study Extent: Transect surveys were conducted to assess the prevalence of epidermal lesions in sea stars around Port Foster’s bay (Deception Island) during the Antarctic expedition ACTIQUIM-4 (January–February 2013). Five haphazardly chosen replicate 50-m linear transects were surveyed at 5 m and 15 m depth at eight sites around the bay (80 transects in total). Apparently healthy O. validus and specimens with lesions were recorded within 2 m of each transect line. The census was repeated in 2016.

Method step description:

  1. DNA from healthy and lesioned tissues of healthy and diseased stars were extracted using a modified C-TAB organic extraction protocol for amplicon deep sequencing of ribosomal gene target markers on MiSeq (Illumina), for bacterial/archaeal and fungal community composition, which were performed with a two-PCR protocol and two dual-index strategy. In the first PCR, we used bacterial specific primers to amplify the V3–V4 region of the small-subunit ribosomal RNA (16S) gene (341 F and 785 R); and fungi-specific primers ITS1F41 and ITS2R targeting the internal transcribed spacer 1 (ITS1) region of fungi. Amplifications were performed in 25 µl reactions with NEBNext® Q5® Hot Start HiFi PCR Master Mix (New England Biolabs, Inc.), 0.8 µl BSA (Bovine Serum Albumin; 20 mg/ml), 1 µl of each 5 µM primer, and 1.5 µl of template. Reactions were under the thermocycling profile: 98 °C for 2 min, then 28 cycles of 98 °C for 15 s, 53 °C for 30 s, 72 °C for 30 s, final extension at 72 °C for 2 min. The second Index PCR to attach dual indexes and Illumina sequencing adapters used forward primers with the 5′-3′ Illumina i5 adapter (AATGATACGGCGACCACCGAGATCTACAC), an 8–10 bp barcode and a primer pad; and reverse fusion primers with 5′-3′ Illumina i7 adapter (CAAGCAGAAGACGGCATACGAGAT), an 8–10 bp barcode, a primer pad. Reactions were made in 25 μl with 0.5 µl of each 5 µM primer, and 1 µl of corresponding products from first amplicon PCR reactions diluted (1:30), and with a temperature regime of: 98 °C for 2 min, then 28 cycles of 98 °C for 15 s, 55 °C for 30 s, 72 °C for 30 s, final extension at 72 °C for 2 min. The PCR products were purified and pooled equimolar on Just-a-Plate™ 96 PCR Purification and Normalization Kit plates following manufacturer’s instructions (Charm Biotec).
  2. Paired-end sequencing was performed on an Illumina MiSeq sequencer 2 × 300 flow cell at 10 pM at Core Lab, Hawai’i Institute of Marine Biology (Hawai’i, USA).

Scope
Kernwoorden:
Marien/Kust · Dna sequencing · Metadata · PSW, Antarctica, South Shetland I., Deception I. · Deception Island · Bacteria · Fungi · Odontaster validus Koehler, 1906

Geografische spreiding
Deception Island [Marine Regions]

Spreiding in de tijd
2013 - 2016

Taxonomic coverage
Bacteria [WoRMS]
Fungi [WoRMS]
Odontaster validus Koehler, 1906 [WoRMS]

Parameter
Moleculaire data

Bijdrage door
Stazione Zoologica 'Anton Dohrn' of Naples (SZN), meerdata creator
U.S. Geological Survey (USGS), meerdata creator
University of Barcelona (UB), meerdata creator
Harvard University; Museum of Comparative Zoology (MCZ), meerdata creator

Gerelateerde datasets
Gepubliceerd in:
AntOBIS: Antarctic Ocean Biodiversity Information System, meer
(Gedeeltelijk) opgenomen in:
RAS: Register of Antarctic Species, meer

Dataset status: Afgelopen
Data type: Meta database
Data oorsprong: Onderzoek: veldonderzoek
Metadatarecord aangemaakt: 2019-03-28
Informatie laatst gewijzigd: 2019-04-10
Alle informatie in het Integrated Marine Information System (IMIS) valt onder het VLIZ Privacy beleid